Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 607872
End position: 607907
Length: 36

DNA sequence
>NC_010524, from 607872 to 607907 (36 bp); Leptothrix cholodnii SP-6 GTGTGTCGGGTGTGTCGGGTGTGTCGGGTGTGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 607453-607950	Sequence	Lcho_0559 - hypothetical protein (Protein is coded in complementary strand; from 607950 to 607453)