Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 602655
End position: 602690
Length: 36

DNA sequence
>NC_010524, from 602655 to 602690 (36 bp); Leptothrix cholodnii SP-6 GCCGCCGCCGCTGCTGCCGCCGCGTCCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 602524-603075	Sequence	Lcho_0555 - ssDNA-binding protein (Protein is coded in complementary strand; from 603075 to 602524)