Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4775933
End position: 4775956
Length: 24

DNA sequence
>NC_010524, from 4775933 to 4775956 (24 bp); Leptothrix cholodnii SP-6 GCCAGCGTCAGCGCCAGCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4774685-4777066	Sequence	Lcho_4267 - hypothetical protein (Protein is coded in complementary strand; from 4777066 to 4774685)