Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4685188
End position: 4685217
Length: 30

DNA sequence
>NC_010524, from 4685188 to 4685217 (30 bp); Leptothrix cholodnii SP-6 CGGTGCCGATGCCGATGCCGGTGTCGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4685004-4686476	Sequence	Lcho_4177 - PAS/PAC sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 4686476 to 4685004)