Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4641270
End position: 4641317
Length: 48

DNA sequence
>NC_010524, from 4641270 to 4641317 (48 bp); Leptothrix cholodnii SP-6 CGGCGACCGGCGAGGCGACCGACGCAGCCACCGGCGCGGCGGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4640357-4641436	Sequence	Lcho_4133 - PpiC-type peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 4641436 to 4640357)