Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4628960
End position: 4628986
Length: 27

DNA sequence
>NC_010524, from 4628960 to 4628986 (27 bp); Leptothrix cholodnii SP-6 CCAGCGCCACCAGCACCACCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4628188-4629222	Sequence	Lcho_4122 - hypothetical protein (Protein is coded in complementary strand; from 4629222 to 4628188)