Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4456923
End position: 4456958
Length: 36

DNA sequence
>NC_010524, from 4456923 to 4456958 (36 bp); Leptothrix cholodnii SP-6 CACCGCCAGCACCGACGCCAGCACCAGCCCCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4454974-4457307	Sequence	Lcho_3968 - methyl-accepting chemotaxis sensory transducer (Protein is coded in complementary strand; from 4457307 to 4454974)