Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4315691
End position: 4315717
Length: 27

DNA sequence
>NC_010524, from 4315691 to 4315717 (27 bp); Leptothrix cholodnii SP-6 GCCGTTCGAGCCATTCGAGCCGTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4314882-4316267	Sequence	Lcho_3848 - hypothetical protein (Protein is coded in complementary strand; from 4316267 to 4314882)