Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4150001
End position: 4150036
Length: 36

DNA sequence
>NC_010524, from 4150001 to 4150036 (36 bp); Leptothrix cholodnii SP-6 TCTTGACCGGCGCCTTGGCCGGCGCCTTGACCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4149979-4150917	Sequence	Lcho_3710 - peptidoglycan-binding domain-containing protein (Protein is coded in complementary strand; from 4150917 to 4149979)