Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 408235
End position: 408261
Length: 27

DNA sequence
>NC_010524, from 408235 to 408261 (27 bp); Leptothrix cholodnii SP-6 ATCGCCTGCAGCGCCTGCATCGCCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 407485-408567	Sequence	Lcho_0373 - Mg2 transporter protein CorA family protein (Protein is coded in complementary strand; from 408567 to 407485)