Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4040004
End position: 4040027
Length: 24

DNA sequence
>NC_010524, from 4040004 to 4040027 (24 bp); Leptothrix cholodnii SP-6 GGCGGCGGCGGGGGCCGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4039489-4040094	Sequence	Lcho_3617 - hypothetical protein (Protein is coded in complementary strand; from 4040094 to 4039489)