Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 4034407
End position: 4034433
Length: 27

DNA sequence
>NC_010524, from 4034407 to 4034433 (27 bp); Leptothrix cholodnii SP-6 CAGCAGCGCCAGCAGCACGAGCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4033139-4035025	Sequence	Lcho_3611 - TRAP C4-dicarboxylate transport system permease DctM (Protein is coded in complementary strand; from 4035025 to 4033139)