Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3737073
End position: 3737108
Length: 36

DNA sequence
>NC_010524, from 3737073 to 3737108 (36 bp); Leptothrix cholodnii SP-6 CGCGGGCCTCGCCGAGGGCCTCGTTGCCGGCCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3737030-3738025	Sequence	Lcho_3362 - phenol 2-monooxygenase (Protein is coded in complementary strand; from 3738025 to 3737030)