Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3725136
End position: 3725159
Length: 24

DNA sequence
>NC_010524, from 3725136 to 3725159 (24 bp); Leptothrix cholodnii SP-6 CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3724801-3725793	Sequence	Lcho_3347 - integral membrane protein TerC (Protein is coded in complementary strand; from 3725793 to 3724801)