Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3636301
End position: 3636324
Length: 24

DNA sequence
>NC_010524, from 3636301 to 3636324 (24 bp); Leptothrix cholodnii SP-6 GCGGTCGCAGTCGCGGTCGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3636292-3636549	Sequence	Lcho_3273 - hypothetical protein (Protein is coded in complementary strand; from 3636549 to 3636292)