Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3588528
End position: 3588551
Length: 24

DNA sequence
>NC_010524, from 3588528 to 3588551 (24 bp); Leptothrix cholodnii SP-6 GGCTGCGGCTGCGGCGGCGCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3588138-3588815	Sequence	Lcho_3235 - TonB family protein (Protein is coded in complementary strand; from 3588815 to 3588138)