Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3586662
End position: 3586685
Length: 24

DNA sequence
>NC_010524, from 3586662 to 3586685 (24 bp); Leptothrix cholodnii SP-6 ATCAGCATCACCAGCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3586341-3586781	Sequence	Lcho_3232 - biopolymer transport protein ExbD/TolR (Protein is coded in complementary strand; from 3586781 to 3586341)