Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 35586
End position: 35615
Length: 30

DNA sequence
>NC_010524, from 35586 to 35615 (30 bp); Leptothrix cholodnii SP-6 GGGGCAGGGGCAGGGGCAGGGGCAGGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 35295-36716	Sequence	Lcho_0031 - hypothetical protein (Protein is coded in complementary strand; from 36716 to 35295)