Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3459532
End position: 3459567
Length: 36

DNA sequence
>NC_010524, from 3459532 to 3459567 (36 bp); Leptothrix cholodnii SP-6 GATCACGCCGTCGATCACGCTGTCGATCACCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3459317-3459862	Sequence	Lcho_3132 - formaldehyde-activating enzyme (Protein is coded in complementary strand; from 3459862 to 3459317)