Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3450384
End position: 3450407
Length: 24

DNA sequence
>NC_010524, from 3450384 to 3450407 (24 bp); Leptothrix cholodnii SP-6 GCGGCAGCGGCCGGGGCAGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3450261-3450782	Sequence	Lcho_3120 - glyoxalase/bleomycin resistance protein/dioxygenase (Protein is coded in complementary strand; from 3450782 to 3450261)