Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3321777
End position: 3321812
Length: 36

DNA sequence
>NC_010524, from 3321777 to 3321812 (36 bp); Leptothrix cholodnii SP-6 CCGCCGCCAGCGCCACCGCCTGCGCCGCCGGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3321035-3322459	Sequence	Lcho_3006 - FAD linked oxidase domain-containing protein (Protein is coded in complementary strand; from 3322459 to 3321035)