Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3108372
End position: 3108395
Length: 24

DNA sequence
>NC_010524, from 3108372 to 3108395 (24 bp); Leptothrix cholodnii SP-6 GCTCCAGATCCAGCGCCAGCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3107075-3110350	Sequence	Lcho_2822 - carbamoyl-phosphate synthase large subunit (Protein is coded in complementary strand; from 3110350 to 3107075)