Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 3007854
End position: 3007880
Length: 27

DNA sequence
>NC_010524, from 3007854 to 3007880 (27 bp); Leptothrix cholodnii SP-6 CGAGCTGGTCGCGCTGGTCGAGCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3006548-3008470	Sequence	Lcho_2725 - flagellar hook-associated protein FlgK (Protein is coded in complementary strand; from 3008470 to 3006548)