Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2999198
End position: 2999230
Length: 33

DNA sequence
>NC_010524, from 2999198 to 2999230 (33 bp); Leptothrix cholodnii SP-6 CGCATCAGCGCCGGATCAGCGCCGGATCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2999225-3000355	Sequence	Lcho_2720 - hypothetical protein (Protein is coded in complementary strand; from 3000355 to 2999225)