Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2848942
End position: 2848968
Length: 27

DNA sequence
>NC_010524, from 2848942 to 2848968 (27 bp); Leptothrix cholodnii SP-6 GCGTCGGCCGCATCGGCCGCATCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2848924-2850177	Sequence	Lcho_2603 - transglutaminase domain-containing protein (Protein is coded in complementary strand; from 2850177 to 2848924)