Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2739389
End position: 2739413
Length: 25

DNA sequence
>NC_010524, from 2739389 to 2739413 (25 bp); Leptothrix cholodnii SP-6 GCCCCGGCCCGCGCCGCCCCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2737168-2739534	Sequence	Lcho_2510 - helicase c2 (Protein is coded in complementary strand; from 2739534 to 2737168)