Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2730366
End position: 2730401
Length: 36

DNA sequence
>NC_010524, from 2730366 to 2730401 (36 bp); Leptothrix cholodnii SP-6 CCTCGGCATCGGCATCGGCGTCGGCCTCGGCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2730335-2732641	Sequence	Lcho_2505 - NAD-dependent DNA ligase (Protein is coded in complementary strand; from 2732641 to 2730335)