Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2598161
End position: 2598196
Length: 36

DNA sequence
>NC_010524, from 2598161 to 2598196 (36 bp); Leptothrix cholodnii SP-6 CGGTGCCGATGCCGATGCCGATGCCGGTGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2597241-2598269	Sequence	Lcho_2389 - putative poly-gamma-glutamate biosynthesis enzyme (Protein is coded in complementary strand; from 2598269 to 2597241)