Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2512229
End position: 2512252
Length: 24

DNA sequence
>NC_010524, from 2512229 to 2512252 (24 bp); Leptothrix cholodnii SP-6 CCAGCACCAGCGCCTGCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2511994-2512842	Sequence	Lcho_2313 - TatD-like deoxyribonuclease (Protein is coded in complementary strand; from 2512842 to 2511994)