Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2510461
End position: 2510487
Length: 27

DNA sequence
>NC_010524, from 2510461 to 2510487 (27 bp); Leptothrix cholodnii SP-6 GCGTGGCCGACGTGGCCGACGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2508681-2510528	Sequence	Lcho_2310 - type II secretion system protein E (Protein is coded in complementary strand; from 2510528 to 2508681)