Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2497303
End position: 2497347
Length: 45

DNA sequence
>NC_010524, from 2497303 to 2497347 (45 bp); Leptothrix cholodnii SP-6 ACGACCCGACGCAGGACAACCCGAAGCAGGACGACGCCATGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2497300-2498706	Sequence	Lcho_2301 - HlyD family type I secretion membrane fusion protein