Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2436795
End position: 2436818
Length: 24

DNA sequence
>NC_010524, from 2436795 to 2436818 (24 bp); Leptothrix cholodnii SP-6 CGCGCACGCGCACGCTCACACGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2435945-2441692	Sequence	Lcho_2232 - Phage-like protein tail component-like protein (Protein is coded in complementary strand; from 2441692 to 2435945)