Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2299515
End position: 2299538
Length: 24

DNA sequence
>NC_010524, from 2299515 to 2299538 (24 bp); Leptothrix cholodnii SP-6 CGCTGCTGCTGCCGCTGGCGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2299239-2300870	Sequence	Lcho_2103 - binding-protein-dependent transport system inner membrane protein