Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2233709
End position: 2233732
Length: 24

DNA sequence
>NC_010524, from 2233709 to 2233732 (24 bp); Leptothrix cholodnii SP-6 CAGCGCCAGTGCCTGCGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2232546-2234513	Sequence	Lcho_2054 - tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC (Protein is coded in complementary strand; from 2234513 to 2232546)