Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2146015
End position: 2146041
Length: 27

DNA sequence
>NC_010524, from 2146015 to 2146041 (27 bp); Leptothrix cholodnii SP-6 CGGTGCCGCCGGTGACGCCGGTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2145157-2146275	Sequence	Lcho_1977 - phosphoribosylformylglycinamidine cyclo-ligase