Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2143749
End position: 2143784
Length: 36

DNA sequence
>NC_010524, from 2143749 to 2143784 (36 bp); Leptothrix cholodnii SP-6 TCGGGGCAGCCATCGGGGCAGCAACCGGGGCAGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2143136-2145088	Sequence	Lcho_1976 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 2145088 to 2143136)