Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2099623
End position: 2099646
Length: 24

DNA sequence
>NC_010524, from 2099623 to 2099646 (24 bp); Leptothrix cholodnii SP-6 ATCAGCATCACCAGCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2099299-2099727	Sequence	Lcho_1936 - biopolymer transport protein ExbD/TolR (Protein is coded in complementary strand; from 2099727 to 2099299)