Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 2084097
End position: 2084123
Length: 27

DNA sequence
>NC_010524, from 2084097 to 2084123 (27 bp); Leptothrix cholodnii SP-6 CTTCGCCGGCTTCGCGGGCGTCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2083973-2084734	Sequence	Lcho_1922 surE stationary phase survival protein SurE (Protein is coded in complementary strand; from 2084734 to 2083973)