Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 195279
End position: 195308
Length: 30

DNA sequence
>NC_010524, from 195279 to 195308 (30 bp); Leptothrix cholodnii SP-6 CGCCGCCGCCGTAGCCGCCGCCACCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 195272-195745	Sequence	Lcho_0186 - RNP-1 like RNA-binding protein (Protein is coded in complementary strand; from 195745 to 195272)