Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1871056
End position: 1871079
Length: 24

DNA sequence
>NC_010524, from 1871056 to 1871079 (24 bp); Leptothrix cholodnii SP-6 TGCCGCTGACGCCGCCGCTGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1869598-1872048	Sequence	Lcho_1750 pheT phenylalanyl-tRNA synthetase subunit beta