Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1743812
End position: 1743835
Length: 24

DNA sequence
>NC_010524, from 1743812 to 1743835 (24 bp); Leptothrix cholodnii SP-6 CGCTGCTGCTGCCGGTGCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1743563-1745830	Sequence	Lcho_1641 - PAS/PAC sensor-containing diguanylate cyclase