Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1742236
End position: 1742259
Length: 24

DNA sequence
>NC_010524, from 1742236 to 1742259 (24 bp); Leptothrix cholodnii SP-6 CCAGCGCCAGCCCCTGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1741947-1742357	Sequence	Lcho_1639 - hypothetical protein (Protein is coded in complementary strand; from 1742357 to 1741947)