Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1703090
End position: 1703113
Length: 24

DNA sequence
>NC_010524, from 1703090 to 1703113 (24 bp); Leptothrix cholodnii SP-6 GCCACCGCCAGCGCCACCGCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1700657-1703281	Sequence	Lcho_1602 - hypothetical protein (Protein is coded in complementary strand; from 1703281 to 1700657)