Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1649708
End position: 1649731
Length: 24

DNA sequence
>NC_010524, from 1649708 to 1649731 (24 bp); Leptothrix cholodnii SP-6 CGCCGGCGGCGGCGCAGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1649689-1650783	Sequence	Lcho_1555 - threonine aldolase (Protein is coded in complementary strand; from 1650783 to 1649689)