Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 164544
End position: 164567
Length: 24

DNA sequence
>NC_010524, from 164544 to 164567 (24 bp); Leptothrix cholodnii SP-6 GCTGCGACTGCGGTTGCGGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 163308-164651	Sequence	Lcho_0157 - ammonium transporter (Protein is coded in complementary strand; from 164651 to 163308)