Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1542153
End position: 1542176
Length: 24

DNA sequence
>NC_010524, from 1542153 to 1542176 (24 bp); Leptothrix cholodnii SP-6 GCGCCAGCGCCGCCGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1540934-1542817	Sequence	Lcho_1462 - respiratory-chain NADH dehydrogenase domain-containing protein (Protein is coded in complementary strand; from 1542817 to 1540934)