Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1461958
End position: 1461981
Length: 24

DNA sequence
>NC_010524, from 1461958 to 1461981 (24 bp); Leptothrix cholodnii SP-6 GTGGCGGTGGTGGTGGCGGTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1461883-1463175	Sequence	Lcho_1378 - fibronectin type III domain-containing protein