Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1429154
End position: 1429178
Length: 25

DNA sequence
>NC_010524, from 1429154 to 1429178 (25 bp); Leptothrix cholodnii SP-6 ATCGGTTCGGATCGGATCAGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1429171-1429506	Sequence	Lcho_1344 - hypothetical protein (Protein is coded in complementary strand; from 1429506 to 1429171)