Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1423683
End position: 1423706
Length: 24

DNA sequence
>NC_010524, from 1423683 to 1423706 (24 bp); Leptothrix cholodnii SP-6 CGCGGCCGAGGCCGCTGCCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1423663-1424364	Sequence	Lcho_1339 - NapC/NirT cytochrome c domain-containing protein (Protein is coded in complementary strand; from 1424364 to 1423663)