Sequence retrieval

Genome: Leptothrix cholodnii SP-6
Start position: 1313614
End position: 1313640
Length: 27

DNA sequence
>NC_010524, from 1313614 to 1313640 (27 bp); Leptothrix cholodnii SP-6 CCAGCACCAGCAGCACCAGCAGCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1312818-1313771	Sequence	Lcho_1227 - hypothetical protein (Protein is coded in complementary strand; from 1313771 to 1312818)